Skip to main content
Addgene

pU6_rd12_nsgRNA(PP7)
(Plasmid #232436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232436 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    phU6
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
  • gRNA/shRNA sequence
    CTGGCAGTCTCCTCCGATGT
  • Species
    Synthetic; Multiple
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HELMHOLTZ MUNICH has filed a patent (PCT/EP2025/053730) disclosing the capabilities of Material, and retains ownership rights to pU6_rd12_nsgRNA(PP7) Material.

Recipient agrees not to file for any intellectual property protection for Material.

Please note that any use of the Material or the HELMHOLTZ MUNICH Information for any commercial purpose - or by, on behalf of or in collaboration with any for-profit entity - requires a license from HELMHOLTZ MUNICH. To obtain such a license, please contact HELMHOLTZ MUNICH by directing your request to: [email protected]

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6_rd12_nsgRNA(PP7) was a gift from Gil Westmeyer (Addgene plasmid # 232436 ; http://n2t.net/addgene:232436 ; RRID:Addgene_232436)
  • For your References section:

    Engineered nucleocytosolic vehicles for loading of programmable editors. Geilenkeuser J, Armbrust N, Steinmassl E, Du SW, Schmidt S, Binder EMH, Li Y, Warsing NW, Wendel SV, von der Linde F, Schiele EM, Niu X, Stroppel L, Berezin O, Santl TH, Orschmann T, Nelson K, Gruber C, Palczewska G, Menezes CR, Risaliti E, Engfer ZJ, Koleci N, Schmidts A, Geerlof A, Palczewski K, Westmeyer GG, Truong DJ. Cell. 2025 May 15;188(10):2637-2655.e31. doi: 10.1016/j.cell.2025.03.015. Epub 2025 Apr 9. 10.1016/j.cell.2025.03.015 PubMed 40209705