3xFlag-Rab34
(Plasmid
#232458)
-
PurposeExpresses 3xFlag-tagged human Rab34 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+N-3xFlag Cloning Vector (#196651)
- Backbone size w/o insert (bp) 4160
- Total vector size (bp) 4910
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab34
-
SpeciesH. sapiens (human)
-
Insert Size (bp)750
-
Entrez GeneRAB34 (a.k.a. NARR, OFD20, RAB39, RAH)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
- 3′ sequencing primer CACTGCATTCTAGTTCTGGT (CSR) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFlag-Rab34 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 232458 ; http://n2t.net/addgene:232458 ; RRID:Addgene_232458)