pB-TR-TTHA
(Plasmid
#232479)
-
PurposeTetracycline inducible PiggyBac vector expressing bacterial TTHA1718 (TTHA) gene gene including flag-tag (DYKDDDDK) on the 3' end
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-TetO-CMV-MCS-EF1a-TetR-T2A-Puro
-
Backbone manufacturerSBI -System Biosciences (original plasmid inducible PiggyBac Cumate Switch vector)
- Backbone size w/o insert (bp) 8848
- Total vector size (bp) 9050
-
Modifications to backbonethe cumate operator (CuO) and repressor (CuR) from original plasmid were replaced with the tetracycline operator (TetO) and repressor (TetRep; TR)
-
Vector typeMammalian Expression ; transposon system
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThermus thermophilus HB8
-
Alt nameThermus thermophilus HB8
-
SpeciesThermus thermophilus
-
Insert Size (bp)198
-
GenBank IDAP008226
- Promoter CMV-TetO
-
Tag
/ Fusion Protein
- DYKDDDDK (FLAG-tag) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGACGCCATCCACGCTGTTTTGACCTC
- 3′ sequencing primer agggtgcgtacggccctggggacgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-TR-TTHA was a gift from Lukas Trantirek (Addgene plasmid # 232479 ; http://n2t.net/addgene:232479 ; RRID:Addgene_232479) -
For your References section:
Protein structure and interactions elucidated with in-cell NMR for different cell cycle phases and in 3D human tissue models. Rynes J, Istvankova E, Dzurov Krafcikova M, Luchinat E, Barbieri L, Banci L, Kamarytova K, Loja T, Fafilek B, Rico-Llanos G, Krejci P, Macurek L, Foldynova-Trantirkova S, Trantirek L. Commun Biol. 2025 Feb 7;8(1):194. doi: 10.1038/s42003-025-07607-w. 10.1038/s42003-025-07607-w PubMed 39920376