Skip to main content

pHLsec hSOD1
(Plasmid #232481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232481 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHLsec
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 4980
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens superoxide dismutase 1
  • Alt name
    SOD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    462
  • GenBank ID
    EF151142.1
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CAG
  • Tag / Fusion Protein
    • DYKDDDDK (FLAG-tag) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer acagctcctgggcaacgtgctg
  • 3′ sequencing primer agccagggcattggccacaccagcca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLsec hSOD1 was a gift from Lukas Trantirek (Addgene plasmid # 232481 ; http://n2t.net/addgene:232481 ; RRID:Addgene_232481)
  • For your References section:

    Protein structure and interactions elucidated with in-cell NMR for different cell cycle phases and in 3D human tissue models. Rynes J, Istvankova E, Dzurov Krafcikova M, Luchinat E, Barbieri L, Banci L, Kamarytova K, Loja T, Fafilek B, Rico-Llanos G, Krejci P, Macurek L, Foldynova-Trantirkova S, Trantirek L. Commun Biol. 2025 Feb 7;8(1):194. doi: 10.1038/s42003-025-07607-w. 10.1038/s42003-025-07607-w PubMed 39920376