Skip to main content

pJAK184.tetR.PT5-3.dCas9
(Plasmid #232482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232482 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJAK184
  • Backbone size w/o insert (bp) 9357
  • Total vector size (bp) 13309
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Catalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system
  • Alt name
    dCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4107
  • Promoter TetR-PT5-3

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer tttcacatttgccgttttgt
  • 3′ sequencing primer tgaccaaaatcccttaacgtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains up- and down-stream homologous regions to insert dCas9 under TetR control into the genome downstream of the bacitracin permease. The promoter driving dCas9 has been modified to provide sufficient induction on a single copy system without appreciable 'leakiness' when not induced.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAK184.tetR.PT5-3.dCas9 was a gift from James Collins (Addgene plasmid # 232482 ; http://n2t.net/addgene:232482 ; RRID:Addgene_232482)
  • For your References section:

    Plasmid sequences and availability of a two-plasmid system for CRISPRi knockdown of Clostridioides difficile genes without antibiotic selection. Chua M, Erickson D, Collins J. Microbiol Resour Announc. 2025 Apr 28:e0011625. doi: 10.1128/mra.00116-25. 10.1128/mra.00116-25 PubMed 40293262