pJAK184.tetR.PT5-3.dCas9
(Plasmid
#232482)
-
Purposeoptimized ahTet inducible dCas9 for insertion into C. difficile genome
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJAK184
- Backbone size w/o insert (bp) 9357
- Total vector size (bp) 13309
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCatalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system
-
Alt namedCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4107
- Promoter TetR-PT5-3
Cloning Information
- Cloning method Other
- 5′ sequencing primer tttcacatttgccgttttgt
- 3′ sequencing primer tgaccaaaatcccttaacgtg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid contains up- and down-stream homologous regions to insert dCas9 under TetR control into the genome downstream of the bacitracin permease. The promoter driving dCas9 has been modified to provide sufficient induction on a single copy system without appreciable 'leakiness' when not induced.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJAK184.tetR.PT5-3.dCas9 was a gift from James Collins (Addgene plasmid # 232482 ; http://n2t.net/addgene:232482 ; RRID:Addgene_232482) -
For your References section:
Plasmid sequences and availability of a two-plasmid system for CRISPRi knockdown of Clostridioides difficile genes without antibiotic selection. Chua M, Erickson D, Collins J. Microbiol Resour Announc. 2025 Apr 28:e0011625. doi: 10.1128/mra.00116-25. 10.1128/mra.00116-25 PubMed 40293262