pJC.15A.sgRNA.TA
(Plasmid
#232483)
-
PurposesgRNA cloning backbone for expression of sgRNA in C. difficile. Contains TA system to enable maintenence without antibiotic selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232483 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRPF185
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDoes not require antibiotic maintenance following conjugation into C. difficile.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameToxin-antitoxin System from CD630
-
SpeciesC. difficile
-
Insert Size (bp)615
- Promoter native promoter
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer cccactttcacagccgcctcaatacttataaag
- 3′ sequencing primer ATGATTATTCATTTTTTTTATATAAACAATGAAATTCAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemedium-copy-number p15A origin of replication
-
Alt namep15A
-
Insert Size (bp)546
- Promoter native promoter
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer tgctagattctaaaatagCAAATTAAGCAGAAGGCCATCC
- 3′ sequencing primer aggcggtaatacggttcggcctaggagatacttaaca (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namemCherry
- Promoter P3 constitutive promoter
Cloning Information for Gene/Insert 3
- Cloning method Other
- 5′ sequencing primer TATATAAAAAAAATGAATAATCATTGATTGCTCGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pJC.15A.sgRNA.TA carries the gene encoding the red fluorescent protein mCherry and a toxin-antitoxin system that enables plasmid maintenance without antibiotics. The mCherry gene is flanked by two BsmBI sites to allow for easy replacement with sgRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJC.15A.sgRNA.TA was a gift from James Collins (Addgene plasmid # 232483 ; http://n2t.net/addgene:232483 ; RRID:Addgene_232483) -
For your References section:
Plasmid sequences and availability of a two-plasmid system for CRISPRi knockdown of Clostridioides difficile genes without antibiotic selection. Chua M, Erickson D, Collins J. Microbiol Resour Announc. 2025 Apr 28:e0011625. doi: 10.1128/mra.00116-25. 10.1128/mra.00116-25 PubMed 40293262