pBMN-MEF2A
(Plasmid
#232626)
-
PurposeLentiviral plasmid expressing human MEF2A.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBMN(CMV-copGFP-Puro)
-
Backbone manufacturerConstructed from pGreenPuro (SBI) by Magnus Essand Lab
-
Modifications to backboneCMV promoter was replaced with the CMV promoter in pCDNA3.1. The CDS of human MEF2A was amplified from hMEF2A WT (Addgene #118354).
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMEF2A
-
SpeciesH. sapiens (human)
-
Entrez GeneMEF2A (a.k.a. ADCAD1, RSRFC4, RSRFC9, mef2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA-3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCACCGTGGGCTTGTACTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe CDS of human MEF2A was amplified from hMEF2A WT (Addgene #118354)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMN-MEF2A was a gift from Claes Wadelius (Addgene plasmid # 232626 ; http://n2t.net/addgene:232626 ; RRID:Addgene_232626) -
For your References section:
Gain-of-function enhancer variant near KCNB1 causes familial ST-depression syndrome. Christensen AH, Pan G, Marvig RL, Rodriguez Gonzalez FG, Vissing CR, Silajdzija E, Frosted R, Girma EG, Gabrielaite M, Jensen HK, Rossing K, Henriksen FL, Sandgaard NCF, Ahlberg G, Ghouse J, Lundegaard PR, Weischenfeldt J, Wadelius C, Bundgaard H. Eur Heart J. 2025 Apr 10:ehaf213. doi: 10.1093/eurheartj/ehaf213. 10.1093/eurheartj/ehaf213 PubMed 40208226