Skip to main content
Addgene

pBMN-MEF2C
(Plasmid #232627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232627 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBMN(CMV-copGFP-Puro)
  • Backbone manufacturer
    Constructed from pGreenPuro (SBI) by Magnus Essand Lab
  • Modifications to backbone
    CMV promoter was replaced with the CMV promoter in pCDNA3.1. The CDS of mouse MEF2C was amplified from pcDNA3.1-MEF2C-HA (Addgene #32515).
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MEF2C
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mef2c (a.k.a. 5430401D19Rik, 9930028G15Rik, Mef2)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA-3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCACCGTGGGCTTGTACTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CDS of mouse MEF2C was amplified from pcDNA3.1-MEF2C-HA (Addgene #32515)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN-MEF2C was a gift from Claes Wadelius (Addgene plasmid # 232627 ; http://n2t.net/addgene:232627 ; RRID:Addgene_232627)
  • For your References section:

    Gain-of-function enhancer variant near KCNB1 causes familial ST-depression syndrome. Christensen AH, Pan G, Marvig RL, Rodriguez Gonzalez FG, Vissing CR, Silajdzija E, Frosted R, Girma EG, Gabrielaite M, Jensen HK, Rossing K, Henriksen FL, Sandgaard NCF, Ahlberg G, Ghouse J, Lundegaard PR, Weischenfeldt J, Wadelius C, Bundgaard H. Eur Heart J. 2025 Apr 10:ehaf213. doi: 10.1093/eurheartj/ehaf213. 10.1093/eurheartj/ehaf213 PubMed 40208226