pLAS2w.Phyg-CHST8 (3A)
(Plasmid
#232651)
-
Purposeexpresses CHST8 REP-to-AAA mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLAS2w.Phyg
-
Backbone manufacturerNational RNAi Core Facility at Academia Sinica
- Backbone size w/o insert (bp) 8564
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHST8 (3A)
-
Alt nameGALNAC4ST1
-
Alt nameGalNAc4ST
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1355
-
MutationR258A, E259A, P260A
-
Entrez GeneCHST8 (a.k.a. GALNAC4ST1, GalNAc4ST, PSS3)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (C terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer ATTCTTTCCCCTGCACTGTAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLAS2w.Phyg-CHST8 (3A) was a gift from Chen-Yang Shen (Addgene plasmid # 232651 ; http://n2t.net/addgene:232651 ; RRID:Addgene_232651) -
For your References section:
Genetic insights into carbohydrate sulfotransferase 8 and its impact on the immunotherapy efficacy of cancer. Chou WC, Chen WT, Kuo CT, Chang YM, Lu YS, Li CW, Hung MC, Shen CY. Cell Rep. 2024 Jan 23;43(1):113641. doi: 10.1016/j.celrep.2023.113641. Epub 2023 Dec 30. 10.1016/j.celrep.2023.113641 PubMed 38165805