PE-pegRNA(BG)-nsgRNA(BG)
(Plasmid
#232727)
-
PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
-
gRNA/shRNA sequencepegRNA(BG): CACCGCTCGTGACCACCCTGACCCA; nsgRNA(BG): CACCGGACGTAGCCTTCGGGCATGG;
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer M13 Forward
- 3′ sequencing primer M13 Reverse
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe U6 promoters are from pHSG1C3 (Plasmid #164423).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PE-pegRNA(BG)-nsgRNA(BG) was a gift from David Brafman (Addgene plasmid # 232727 ; http://n2t.net/addgene:232727 ; RRID:Addgene_232727) -
For your References section:
PINE-TREE enables highly efficient genetic modification of human cell lines. Frisch C, Kostes WW, Galyon B, Whitman B, Tekel SJ, Standage-Beier K, Srinivasan G, Wang X, Brafman DA. Mol Ther Nucleic Acids. 2023 Jul 17;33:483-492. doi: 10.1016/j.omtn.2023.07.007. eCollection 2023 Sep 12. 10.1016/j.omtn.2023.07.007 PubMed 37588683