pIVT-Bxb1-I87L
(Plasmid
#232749)
-
PurposeIVT template for making modRNA encoding mutant Bxb1 modRNA (I87L)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR4
- Backbone size w/o insert (bp) 1600
- Total vector size (bp) 3972
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsdo not overgrow, as the segmented polyA track encoded on the plasmid can truncate in vivo.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBxb1
-
SpeciesSynthetic
-
Insert Size (bp)1557
-
MutationI87L
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGGAAACGCCTGGTATCTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 5' and 3' beta globin UTR sequences flanking the ORF were based on previous literature for effective modRNA expression in hiPSCs: 10.1016/j.crmeth.2022.100290
To generate linear IVT template, digest the plasmid with MluI. The vector encodes a segmented polyA track, obviating the need for polyadenylation after IVT (doi: 10.1261/rna.069286.118).
Due to the inability of nanopore sequencing to accurately read long polyN stretches and the possibility of polyA truncation, the actual length of the polyA tail may differ when propagating the vector. In our hands, we have not seen measurable differences in expression across different plasmid preparations.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIVT-Bxb1-I87L was a gift from Kate Galloway (Addgene plasmid # 232749 ; http://n2t.net/addgene:232749 ; RRID:Addgene_232749) -
For your References section:
STRAIGHT-IN Dual: a platform for dual, single-copy integrations of DNA payloads and gene circuits into human induced pluripotent stem cells. Blanch-Asensio A, Ploessl DS, Wang NB, Mummery CL, Galloway KE, Davis RP. bioRxiv [Preprint]. 2024 Oct 17:2024.10.17.616637. doi: 10.1101/2024.10.17.616637. 10.1101/2024.10.17.616637 PubMed 39464154