pML104-LEU2-2
(Plasmid
#232883)
-
PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepML104
-
Backbone manufacturerLaughery et al, 2015, Yeast
- Backbone size w/o insert (bp) 11240
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLEU2 gRNA
-
Alt nameYCL018W
-
gRNA/shRNA sequenceGGTAGTGTTAGACCTGAACA
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)33
-
Entrez GeneLEU2 (a.k.a. YCL018W)
- Promoter snR52
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (destroyed during cloning)
- 3′ cloning site BclI (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML104-LEU2-2 was a gift from Jolanda Van Leeuwen (Addgene plasmid # 232883 ; http://n2t.net/addgene:232883 ; RRID:Addgene_232883) -
For your References section:
The modifiers that cause changes in gene essentiality. Batte A, Bosch-Guiteras N, Pons C, Ota M, Lopes M, Sharma S, Tellini N, Paltenghi C, Conti M, Kan KT, Ho UL, Wiederkehr M, Barraud J, Ashe M, Aloy P, Liti G, Chabes A, Parts L, van Leeuwen J. Cell Syst. 2026 Mar 2:101515. doi: 10.1016/j.cels.2025.101515. 10.1016/j.cels.2025.101515 PubMed 41775267