pCnCre
(Plasmid
#232907)
-
PurposeElectroporation vector for expression of Cre recombinase in Cuprividus necator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLO3
-
Vector typeCre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
SpeciesSynthetic
-
Insert Size (bp)1032
-
Entrez Genecre (a.k.a. P1_gp003)
- Promoter Ptac-cymO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGTCAGGAACTCGACACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCnCre was a gift from Anita Emmerstorfer-Augustin (Addgene plasmid # 232907 ; http://n2t.net/addgene:232907 ; RRID:Addgene_232907) -
For your References section:
CnRed: Efficient, Marker-free Genome Engineering of Cupriavidus necator H16 by Adapted Lambda Red Recombineering. Arhar S, Pirchner J, Stolterfoht-Stock H, Reicher K, Kourist R, Emmerstorfer-Augustin A. ACS Synth Biol. 2025 Feb 24. doi: 10.1021/acssynbio.4c00757. 10.1021/acssynbio.4c00757 PubMed 39989320