pHRep-HKH1
(Plasmid
#232909)
-
PurposePlasmid for disruption of the phaC1 locus of Cupriavidus necator via homologous recombination
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLO3
- Total vector size (bp) 3475
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKanR
-
SpeciesSynthetic
-
Entrez GenekanR (a.k.a. peH4H_0130)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtactacatcctggacctgcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHRep-HKH1 was a gift from Anita Emmerstorfer-Augustin (Addgene plasmid # 232909 ; http://n2t.net/addgene:232909 ; RRID:Addgene_232909) -
For your References section:
CnRed: Efficient, Marker-free Genome Engineering of Cupriavidus necator H16 by Adapted Lambda Red Recombineering. Arhar S, Pirchner J, Stolterfoht-Stock H, Reicher K, Kourist R, Emmerstorfer-Augustin A. ACS Synth Biol. 2025 Feb 24. doi: 10.1021/acssynbio.4c00757. 10.1021/acssynbio.4c00757 PubMed 39989320