PX330-sgRNA006_CTCF
(Plasmid
#232928)
-
PurposeExpression vector for a sgRNA against the mouse CTCF locus and SpCas9.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX330
-
Backbone manufacturerFeng Zhang (Addgene #42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequencetgaggcggttgaagccattg
-
SpeciesS. pyogenes
-
Entrez GeneCtcf
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gagggcctatttcccatgatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCong et al., 2013 (Science)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX330-sgRNA006_CTCF was a gift from Danny Reinberg (Addgene plasmid # 232928 ; http://n2t.net/addgene:232928 ; RRID:Addgene_232928) -
For your References section:
CTCF-RNA interactions orchestrate cell-specific chromatin loop organization. Lucero K, Han S, Huang P, Qiu X, Mazzoni EO, Reinberg D. bioRxiv, March 19, 2025 10.1101/2025.03.19.643339