Skip to main content

KL063 - pCAGGS-OsTIR1(F74G)-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26
(Plasmid #232929)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232929 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEN113
  • Backbone manufacturer
    Benoit Bruneau (Addgene #86233)
  • Vector type
    Mammalian Expression, Mouse Targeting
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    OsTir1(F74G)
  • Species
    Oryza sativa
  • Mutation
    changed Phenylalanine 74 to Glycine

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer tcacgcgtctgcaggatatcatgacatactttcctgaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Masato Kanemaki (Addgene #140730)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KL063 - pCAGGS-OsTIR1(F74G)-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26 was a gift from Danny Reinberg (Addgene plasmid # 232929 ; http://n2t.net/addgene:232929 ; RRID:Addgene_232929)
  • For your References section:

    CTCF-RNA interactions orchestrate cell-specific chromatin loop organization. Lucero K, Han S, Huang P, Qiu X, Mazzoni EO, Reinberg D. bioRxiv, March 19, 2025 10.1101/2025.03.19.643339