KL063 - pCAGGS-OsTIR1(F74G)-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26
(Plasmid
#232929)
-
PurposeTargeting vector to introduce an OsTir1(F74G) expressing cassette at the mouse Rosa26 locus using Neomycin selection. AID2 degron system. Use with Addgene #64216 sgRNA.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEN113
-
Backbone manufacturerBenoit Bruneau (Addgene #86233)
-
Vector typeMammalian Expression, Mouse Targeting
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOsTir1(F74G)
-
SpeciesOryza sativa
-
Mutationchanged Phenylalanine 74 to Glycine
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer tcacgcgtctgcaggatatcatgacatactttcctgaag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMasato Kanemaki (Addgene #140730)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KL063 - pCAGGS-OsTIR1(F74G)-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26 was a gift from Danny Reinberg (Addgene plasmid # 232929 ; http://n2t.net/addgene:232929 ; RRID:Addgene_232929) -
For your References section:
CTCF-RNA interactions orchestrate cell-specific chromatin loop organization. Lucero K, Han S, Huang P, Qiu X, Mazzoni EO, Reinberg D. bioRxiv, March 19, 2025 10.1101/2025.03.19.643339