pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
(Plasmid
#233080)
-
PurposeExpression vector for sgRNA-S1b and eCas12f1i
-
Depositing Lab
-
Depositing OrganizationKorea University Medical Center
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 233080-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 233080-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX458
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 2978
- Total vector size (bp) 8451
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)5473
- Promoter hU6, CBh
-
Tag
/ Fusion Protein
- 2xFLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 233080-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 233080-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i was a gift from Kyoungmi Kim (Addgene plasmid # 233080 ; http://n2t.net/addgene:233080 ; RRID:Addgene_233080) -
For your References section:
Robust genome editing activity and the applications of enhanced miniature CRISPR-Cas12f1. Park SJ, Ju S, Jung WJ, Jeong TY, Yoon DE, Lee JH, Yang J, Lee H, Choi J, Kim HS, Kim K. Nat Commun. 2025 Jan 15;16(1):677. doi: 10.1038/s41467-025-56048-w. 10.1038/s41467-025-56048-w PubMed 39809780
