PX458-eBFP2-sgRNA_CTCF_ZF1
(Plasmid
#233090)
-
PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerFheng Zhang (Addgene #48138)
-
Modifications to backbonespCas9-T2A-eGFP was modified to spCas9-T2A-eBFP2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namespCas9-T2A-eBFP2
-
gRNA/shRNA sequenceTTTGCAGTTACACATGTCCC
-
Entrez GeneCtcf
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-eBFP2-sgRNA_CTCF_ZF1 was a gift from Danny Reinberg (Addgene plasmid # 233090 ; http://n2t.net/addgene:233090 ; RRID:Addgene_233090) -
For your References section:
CTCF-RNA interactions orchestrate cell-specific chromatin loop organization. Lucero K, Han S, Huang P, Qiu X, Mazzoni EO, Reinberg D. bioRxiv, March 19, 2025 10.1101/2025.03.19.643339