pAtVPZv1.0
(Plasmid
#233147)
-
PurposeExpresses VDE, PsbS, ZEP from A.thaliana
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEarleyGate301
-
Vector typePlant Expression
-
Selectable markersBAR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameResistance to herbicide bialaphos
-
Alt nameBAR resistance gene
-
Insert Size (bp)552
- Promoter mas promoter
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AGACGTACACGGTCGACTCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZeaxanthin epoxidase
-
Alt nameZEP
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2004
-
Entrez GeneABA1 (a.k.a. AT5G67030, ABA DEFICIENT 1, ARABIDOPSIS THALIANA ABA DEFICIENT 1, ARABIDOPSIS THALIANA ZEAXANTHIN EPOXIDASE, ATABA1, ATZEP, IBS3, IMPAIRED IN BABA-INDUCED STERILITY 3, K8A10.10, K8A10_10, LOS6, LOW EXPRESSION OF OSMOTIC STRESS-RESPONSIVE GENES 6, NON-PHOTOCHEMICAL QUENCHING 2, NPQ2, ZEAXANTHIN EPOXIDASE, ZEP)
- Promoter Rbcs1a
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TGTAGATCCTAGTCCACTTG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePhotosystem II subunit S
-
Alt namePsbS
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)798
-
Entrez GeneNPQ4 (a.k.a. AT1G44575, CP22, NONPHOTOCHEMICAL QUENCHING 4, PHOTOSYSTEM II SUBUNIT S, PSBS, PSII-S, T18F15.3, T18F15_3)
- Promoter GAPA-1
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TCCTGTCTGCTACAAACCTT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameVioloxanthin de-epoxidase
-
Alt nameVDE
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1389
-
Entrez GeneNPQ1 (a.k.a. AT1G08550, ARABIDOPSIS VIOLAXANTHIN DE-EPOXIDASE 1, AVDE1, F22O13.3, F22O13_3, VIOLAXANTHIN DE-EPOXIDASE PRECURSOR, non-photochemical quenching 1)
- Promoter FBA-2
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer AGTGAGAGATAAGGGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAtVPZv1.0 was a gift from Krishna Niyogi (Addgene plasmid # 233147 ; http://n2t.net/addgene:233147 ; RRID:Addgene_233147) -
For your References section:
Improving photosynthesis and crop productivity by accelerating recovery from photoprotection. Kromdijk J, Glowacka K, Leonelli L, Gabilly ST, Iwai M, Niyogi KK, Long SP. Science. 2016 Nov 18;354(6314):857-861. doi: 10.1126/science.aai8878. 10.1126/science.aai8878 PubMed 27856901