inducible shSRP19_9 in pLKO tet on
(Plasmid
#233289)
-
PurposeDox inducible expression of SRP19 shRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO tet on
- Total vector size (bp) 8816
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshSRP19
-
gRNA/shRNA sequenceATGAATGGAGACTTCTAATTT
-
SpeciesH. sapiens (human)
-
GenBank IDSRP19
- Promoter Dox
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGGTATCGATCACGAGACTAGCC
- 3′ sequencing primer GACGTGAAGAATGTGCGAGACCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dox inducible expression of SRP19 targeting shRNA. Please visit https://doi.org/10.1101/2024.01.30.578083 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
inducible shSRP19_9 in pLKO tet on was a gift from Sefi Rosenbluh (Addgene plasmid # 233289 ; http://n2t.net/addgene:233289 ; RRID:Addgene_233289) -
For your References section:
SRP19 and the protein secretion machinery is a targetable vulnerability in cancers with APC loss. Xi X, Liu L, Tuano N, Tailhades J, Mouradov D, Steen J, Sieber O, Cryle M, Nguyen-Dumont T, Segelov E, Rosenbluh J. Proc Natl Acad Sci U S A. 2025 Apr 15;122(15):e2409677122. doi: 10.1073/pnas.2409677122. Epub 2025 Apr 10. 10.1073/pnas.2409677122 PubMed 40208946