pFNC-5
(Plasmid
#233297)
-
PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. TcR, easily curable via sucrose counterselection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233297 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSEVA5213
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 7346
-
Modifications to backboneIntroduced sacB in the gadget site; introduced BxbI phage integrase in the MCS
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameBxbI phage integrase
-
SpeciesBxbI phage
-
Insert Size (bp)1503
- Promoter PEM7
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer GATCTCAAGAAGATCCTTTGATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesacB
-
SpeciesBacillus subtilis
-
Insert Size (bp)1422
- Promoter unknown
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer aaatgcaagacctaaaatgtgtaaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFNC-5 was a gift from Pablo Ivan Nikel (Addgene plasmid # 233297 ; http://n2t.net/addgene:233297 ; RRID:Addgene_233297) -
For your References section:
CIFR (Clone-Integrate-Flip-out-Repeat): A toolset for iterative genome and pathway engineering of Gram-negative bacteria. Federici F, Luppino F, Aguilar-Vilar C, Mazaraki ME, Petersen LB, Ahonen L, Nikel PI. Metab Eng. 2025 Jan 6;88:180-195. doi: 10.1016/j.ymben.2025.01.001. 10.1016/j.ymben.2025.01.001 PubMed 39778677