pMSCV-IRES-Thy1.1 HLAA2 CAR
(Plasmid #233472)

• Purpose: A retroviral vector expressing thy1.1 as a marker gene and a second generation HLA-A2 CAR with a myc tag
• Depositing Lab: Megan Levings
• Publication: Wardell et al bioRxiv [Preprint]. 2024 Apr 10:2024.04.06.588414. doi: 10.1101/2024.04.06.588414.

Backbone

• Vector backbone: pMSCV-IRES
• Backbone manufacturer: addgene
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 7863
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: HLA-A2 CAR
• Species: Synthetic
• Insert Size (bp): 1614
• Promoter: 5' LTR
• Tag / Fusion Protein:
  • myc

Cloning Information for Gene/Insert 1

• Cloning method: Gene Synthesis
• 5′ sequencing primer: ttgtacaccctaagcctccg

Gene/Insert 2

• Gene/Insert name: Thy1.1
• Species: M. musculus (mouse)
• Insert Size (bp): 489
• Entrez Gene: Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
• Promoter: IRES

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CAACGTCTGTAGCGACCCTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The HLA-A2 CAR was generated with optimised coding sequence of the variable regions of the Ig heavy and light chains from the anti–HLA-A2 BB7.2 hybridoma (ATCC). The resulting scFv was fused to a Myc epitope tag in the extracellular region to enable cell-surface detection by flow cytometry, a stalk region from mouse CD8α, the transmembrane and intracellular domains of mouse CD28, and mouse CD3ζ.