pN3
(Plasmid
#233520)
-
Purpose(Empty Backbone) Nb Vector Plasmid (under galactose induction), AmpR (E. coli) and HygroR (yeast), Cen6/ARS
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneself-made
-
Backbone manufacturerSamantha Martinusen
- Backbone size (bp) 5858
-
Vector typeBacterial Expression, Yeast Expression
- Promoter pGAL1
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 3′ sequencing primer caacaaaaaattgttaatatacctctatactttaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN3 was a gift from Carl Denard (Addgene plasmid # 233520 ; http://n2t.net/addgene:233520 ; RRID:Addgene_233520)
Map uploaded by the depositor.
