Skip to main content

pN4
(Plasmid #233521)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233521 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pY3
  • Backbone manufacturer
    Samantha Martinusen
  • Backbone size (bp) 6470
  • Modifications to backbone
    Removal of sfGFP dropout gene and flanking sequencing between pGAL1-10 and the ORI gene.
  • Vector type
    Bacterial Expression, Yeast Expression
  • Promoter pGAL1-10
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer caacaaaaaattgttaatatacctctatactttaac
  • 3′ sequencing primer GCTAAAAGTACAGTGGGAACAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN4 was a gift from Carl Denard (Addgene plasmid # 233521 ; http://n2t.net/addgene:233521 ; RRID:Addgene_233521)