pN4
(Plasmid
#233521)
-
Purpose(Empty Backbone) Nb Vector Plasmid (under galactose induction), AmpR (E. coli) and TRP1 (yeast), Cen6/ARS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepY3
-
Backbone manufacturerSamantha Martinusen
- Backbone size (bp) 6470
-
Modifications to backboneRemoval of sfGFP dropout gene and flanking sequencing between pGAL1-10 and the ORI gene.
-
Vector typeBacterial Expression, Yeast Expression
- Promoter pGAL1-10
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer caacaaaaaattgttaatatacctctatactttaac
- 3′ sequencing primer GCTAAAAGTACAGTGGGAACAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN4 was a gift from Carl Denard (Addgene plasmid # 233521 ; http://n2t.net/addgene:233521 ; RRID:Addgene_233521)