pRSET-cfp29
(Plasmid
#233651)
-
PurposeMycobacterium tuberculosis Encapsulin CFP29 expression plasmid in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSET
- Backbone size w/o insert (bp) 2754
- Total vector size (bp) 3552
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab recommends using C41 E. coli for protein expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEncapsulin
-
Alt nameCFP29
-
SpeciesMycobacterium tuberculosis
-
Insert Size (bp)798
- Promoter T7 promoter
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GCTGATACCGCTCGCCGCAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET-cfp29 was a gift from Ye Gao (Addgene plasmid # 233651 ; http://n2t.net/addgene:233651 ; RRID:Addgene_233651) -
For your References section:
In situ and in vitro cryo-EM reveal structures of mycobacterial encapsulin assembly intermediates. Berger C, Lewis C, Gao Y, Knoops K, Lopez-Iglesias C, Peters PJ, Ravelli RBG. Commun Biol. 2025 Feb 15;8(1):245. doi: 10.1038/s42003-025-07660-5. 10.1038/s42003-025-07660-5 PubMed 39955411