pSecUAG_UTu1D
(Plasmid
#233867)
-
PurposeExpresses machinery necessary for selenocysteine incorporation at UAG codons in BL21-derived cells, spectinomycin resistant
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD-myc-HisA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 7383
-
Modifications to backboneRSF origin and spectinomycin resistance were taken from pRSF-Duet1 and used to replace the pBR322 origin and ampicillin resistance of pBAD-myc-HisA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameallo-tRNA UTu1D
-
SpeciesSynthetic
-
Insert Size (bp)90
-
GenBank IDNC_000019
- Promoter araBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namethioredoxin
-
Alt nameTrx1
-
SpeciesTreponema denticola
-
MutationCysteine 32 switched to Selenocysteine (UAG)
-
GenBank IDNC_002967
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gcggctatttaacgaccc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSelenophosphate synthase
-
Alt nameSelD
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)1038
-
Mutationstarts with GUG instead of AUG
-
GenBank IDNF_002098
- Promoter native As SelD
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CTACCACGGTGCCCAAAAGTC
- 3′ sequencing primer GCATTTTCGACAGGCTATTG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameSelenocysteine synthase
-
Alt nameSelA
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)1488
-
GenBank IDNF_003308
- Promoter EM7
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGGCATTATGCCACAAG
- 3′ sequencing primer gccgatatactatgccg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSecUAG_UTu1D was a gift from Natalie Krahn & Dieter Söll (Addgene plasmid # 233867 ; http://n2t.net/addgene:233867 ; RRID:Addgene_233867)