pCS2+ Zf nhsl1b-mNeongreen
(Plasmid
#233883)
-
PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4095
- Total vector size (bp) 9637
-
Vector typeMammalian Expression ; In vitro synthesis of mRNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenhsl1b
-
Alt namenhsl1
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)5546
-
Entrez Genenhsl1b (a.k.a. gukh2, nhsl1, si:ch211-195e3.6)
-
Tag
/ Fusion Protein
- mNeongreen (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tctttttgcaggatccgccaccatgccgtttcccgagaga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.28.526006 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+ Zf nhsl1b-mNeongreen was a gift from Nicolas David (Addgene plasmid # 233883 ; http://n2t.net/addgene:233883 ; RRID:Addgene_233883) -
For your References section:
Nance-Horan-syndrome-like 1b controls mesodermal cell migration by regulating protrusion and actin dynamics during zebrafish gastrulation. Escot S, Hassanein Y, Elouin A, Torres-Paz J, Mellottee L, Ignace A, David NB. Commun Biol. 2025 Feb 28;8(1):328. doi: 10.1038/s42003-025-07689-6. 10.1038/s42003-025-07689-6 PubMed 40021913