pLJC6-NADK2(delta MTS)-3xFLAG
(Plasmid
#233896)
-
Purposelentiviral overexpression vector for NADK2 (delta MTS)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLJC6
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNADK2
-
SpeciesH. sapiens (human)
-
Mutationdelta MTS (see Depositor Comments)
-
Entrez GeneNADK2 (a.k.a. C5orf33, DECRD, MNADK, NADKD1)
- Promoter Ubc
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGC
- 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert sequence is a codon-optimized gBLOCK (IDT). The nucleotides corresponding to the N-terminal 62 amino acids were replaced with a new initiator methionine and GGS linker to remove the endogenous mitochondrial targeting sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC6-NADK2(delta MTS)-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 233896 ; http://n2t.net/addgene:233896 ; RRID:Addgene_233896) -
For your References section:
Cytosolic NADK is conditionally essential for folate-dependent nucleotide synthesis. Flickinger KM, Mellado Fritz CA, Huggler KS, Wade GM, Chang GR, Fox KC, Simcox JA, Cantor JR. Nat Metab. 2025 May 2. doi: 10.1038/s42255-025-01272-3. 10.1038/s42255-025-01272-3 PubMed 40316835