Skip to main content

pLJC6-NADK2(delta MTS)-3xFLAG
(Plasmid #233896)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233896 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLJC6
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NADK2
  • Species
    H. sapiens (human)
  • Mutation
    delta MTS (see Depositor Comments)
  • Entrez Gene
    NADK2 (a.k.a. C5orf33, DECRD, MNADK, NADKD1)
  • Promoter Ubc
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GTAAATTGTCCGCTAAATTCTGGC
  • 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert sequence is a codon-optimized gBLOCK (IDT). The nucleotides corresponding to the N-terminal 62 amino acids were replaced with a new initiator methionine and GGS linker to remove the endogenous mitochondrial targeting sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC6-NADK2(delta MTS)-3xFLAG was a gift from Jason Cantor (Addgene plasmid # 233896 ; http://n2t.net/addgene:233896 ; RRID:Addgene_233896)
  • For your References section:

    Cytosolic NADK is conditionally essential for folate-dependent nucleotide synthesis. Flickinger KM, Mellado Fritz CA, Huggler KS, Wade GM, Chang GR, Fox KC, Simcox JA, Cantor JR. Nat Metab. 2025 May 2. doi: 10.1038/s42255-025-01272-3. 10.1038/s42255-025-01272-3 PubMed 40316835