pLX403_SMARCB1_D277*
(Plasmid
#233901)
-
PurposeInducible vector with SMARCB1 variant 1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLXI_TRC403
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7742
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMARCB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1158
-
MutationD277* (nonsense)
-
Entrez GeneSMARCB1 (a.k.a. BAF47, CSS3, INI-1, INI1, MRD15, PPP1R144, RDT, RTPS1, SNF5, SNF5L1, SWNTS1, Sfh1p, Snr1, hSNFS)
- Promoter TRE
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGAGGTAGGCGTGTACGGTG
- 3′ sequencing primer GACGTGAAGAATGTGCGAGAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6018128/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX403_SMARCB1_D277* was a gift from Andrew Hong (Addgene plasmid # 233901 ; http://n2t.net/addgene:233901 ; RRID:Addgene_233901)