pBAD_AIcrVIA1
(Plasmid
#234052)
-
PurposePlasmid for AIcrVIA1 expression during phage assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH10b is recommended for conducting the phage assays.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAIcrVIA1
-
SpeciesSynthetic
- Promoter araBAD promoter
-
Tag
/ Fusion Protein
- 6XHis (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.05.626932 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD_AIcrVIA1 was a gift from Gavin Knott (Addgene plasmid # 234052 ; http://n2t.net/addgene:234052 ; RRID:Addgene_234052) -
For your References section:
De novo design of potent CRISPR-Cas13 inhibitors. Taveneau C, Chai HX, D'Silva J, Bamert RS, Chen H, Hayes BK, Calvert RW, Purcell J, Curwen DJ, Munder F, Martin LL, Barr JJ, Rosenbluh J, Fareh M, Grinter R, Knott GJ. Nat Chem Biol. 2026 Jan 26. doi: 10.1038/s41589-025-02136-3. 10.1038/s41589-025-02136-3 PubMed 41588195