pHR_CMV_MeltEGFR-37-mCherry
(Plasmid
#234065)
-
PurposeEncodes EGFR intracellular domain controlled by a Melt variant with a switching temperature of 37°C
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeltEGFR-37-mCherry
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_CMV_MeltEGFR-37-mCherry was a gift from Lukasz Bugaj (Addgene plasmid # 234065 ; http://n2t.net/addgene:234065 ; RRID:Addgene_234065) -
For your References section:
A temperature-inducible protein module for control of mammalian cell fate. Benman W, Huang Z, Iyengar P, Wilde D, Mumford TR, Bugaj LJ. Nat Methods. 2025 Jan 23. doi: 10.1038/s41592-024-02572-4. 10.1038/s41592-024-02572-4 PubMed 39849131