pSM-mStayGold
(Plasmid
#234317)
-
Purposecodon-optimized mStayGold with synthetic introns for the expression in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSM
-
Backbone manufacturerCori Bargmann's lab
- Backbone size w/o insert (bp) 3600
- Total vector size (bp) 4331
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC. elegans codon optimized mStayGOld
-
Alt namece_mStayGold
-
SpeciesSynthetic
-
Insert Size (bp)870
-
GenBank ID
-
Tag
/ Fusion Protein
- mStayGold
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer atgaccatgattacgccaa
- 3′ sequencing primer gttgaagagtaattggacttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was generated by replacing the GFP sequence in the pSM (eGFP_unc-54 utr) plasmid with codon-optimized mStayGold.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original mStayGold was described in the following paper.
StayGold variants for molecular fusion and membrane-targeting applications. Ando R, Shimozono S, Ago H, Takagi M, Sugiyama M, Kurokawa H, Hirano M, Niino Y, Ueno G, Ishidate F, Fujiwara T, Okada Y, Yamamoto M, Miyawaki A. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02085-6. 10.1038/s41592-023-02085-6 PubMed 38036853
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSM-mStayGold was a gift from Kota Mizumoto (Addgene plasmid # 234317 ; http://n2t.net/addgene:234317 ; RRID:Addgene_234317) -
For your References section:
Comparison among bright green fluorescent proteins in C. elegans. Ko S, Mizumoto K. MicroPubl Biol. 2025 Jan 18;2025:10.17912/micropub.biology.001447. doi: 10.17912/micropub.biology.001447. eCollection 2025. 10.17912/micropub.biology.001447 PubMed 39897165