Skip to main content

pSM-mStayGold
(Plasmid #234317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234317 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    Cori Bargmann's lab
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 4331
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C. elegans codon optimized mStayGOld
  • Alt name
    ce_mStayGold
  • Species
    Synthetic
  • Insert Size (bp)
    870
  • GenBank ID
  • Tag / Fusion Protein
    • mStayGold

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer atgaccatgattacgccaa
  • 3′ sequencing primer gttgaagagtaattggacttag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated by replacing the GFP sequence in the pSM (eGFP_unc-54 utr) plasmid with codon-optimized mStayGold.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original mStayGold was described in the following paper.
StayGold variants for molecular fusion and membrane-targeting applications. Ando R, Shimozono S, Ago H, Takagi M, Sugiyama M, Kurokawa H, Hirano M, Niino Y, Ueno G, Ishidate F, Fujiwara T, Okada Y, Yamamoto M, Miyawaki A. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02085-6. 10.1038/s41592-023-02085-6 PubMed 38036853

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSM-mStayGold was a gift from Kota Mizumoto (Addgene plasmid # 234317 ; http://n2t.net/addgene:234317 ; RRID:Addgene_234317)
  • For your References section:

    Comparison among bright green fluorescent proteins in C. elegans. Ko S, Mizumoto K. MicroPubl Biol. 2025 Jan 18;2025:10.17912/micropub.biology.001447. doi: 10.17912/micropub.biology.001447. eCollection 2025. 10.17912/micropub.biology.001447 PubMed 39897165