pAPH021
(Plasmid
#234346)
-
PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpK
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMB1
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameType II dCas9 sgRNA
- Promoter lacUV5
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer gaaacggtctgataagagacac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameType II dCas9 sgRNA
- Promoter lacUV5
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer gaaacggtctgataagagacac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.20.595006 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAPH021 was a gift from Jerome Fox (Addgene plasmid # 234346 ; http://n2t.net/addgene:234346 ; RRID:Addgene_234346) -
For your References section:
High-density CRISPRi screens reveal diverse routes to improved acclimation in cyanobacteria. Hren A, Lollini N, Carper DL, Abraham PE, Cameron JC, Fox JM, Eckert CA. Proc Natl Acad Sci U S A. 2025 Mar 25;122(12):e2412625122. doi: 10.1073/pnas.2412625122. Epub 2025 Mar 21. 10.1073/pnas.2412625122 PubMed 40117303