EML8359_pA3A-CBECas9-ALSpro197
(Plasmid
#234353)
-
PurposeBase editor targets to ALS Pro197 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEML8357_pA3A-CBECas9
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameALS
-
gRNA/shRNA sequenceCAAGTCCCTCGTCGTATGAT
-
SpeciesA. thaliana (mustard weed)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GTTTTCCCAGTCACGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EML8359_pA3A-CBECas9-ALSpro197 was a gift from Erh-Min Lai (Addgene plasmid # 234353 ; http://n2t.net/addgene:234353 ; RRID:Addgene_234353) -
For your References section:
Floral stage optimization and immune evasion enhance Agrobacterium-mediated genome editing in Arabidopsis. Liu MS, Huang TK, Wang YC, Wang SC, Wu CH, Kuo CH, Lai EM. New Phytol. 2025 Nov 30. doi: 10.1111/nph.70795. 10.1111/nph.70795 PubMed 41321035