pLX208-cytoFLARE1.0-TF
(Plasmid
#234513)
-
PurposeTranscriptional reporter for detecting calcium increase in HEK293T (transcription factor)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepLX208
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameERT2-MK2-hLOV-TEVcs-NLS-GAL4-FLAG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.13.632875 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX208-cytoFLARE1.0-TF was a gift from Wenjing Wang (Addgene plasmid # 234513 ; http://n2t.net/addgene:234513 ; RRID:Addgene_234513) -
For your References section:
An improved FLARE system for recording and manipulating neuronal activity. Zhou G, Li R, Bartolik O, Ma Y, Wan WW, Meng J, Hu Y, Ye B, Wang W. Cell Rep Methods. 2025 Apr 21;5(4):101012. doi: 10.1016/j.crmeth.2025.101012. Epub 2025 Mar 21. 10.1016/j.crmeth.2025.101012 PubMed 40120579