pAED2
(Plasmid
#234599)
-
PurposeFluorescent reporter of the SOS response
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 3968
- Total vector size (bp) 6022
-
Vector typeBacterial Expression ; reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemScarlet-I
-
SpeciesSynthetic
-
Insert Size (bp)696
-
MutationThe single amino acid substitution T74I found in mScarlet-I results in a marked maturation acceleration in cells, but at the cost of a moderate decrease in fluorescence quantum yield (0.54) and fluorescence lifetime (3.1 ns), although both values are still higher than those of all previously engineered bright mRFPs.
-
GenBank IDAPD76536.1
- Promoter cda
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACATGGTCCTTCTTGAGTTTGTAACAGC
- 3′ sequencing primer TTAGGCGGTCACTTGTACAGCTCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegfp-mut2
-
SpeciesAequorea victoria
-
Insert Size (bp)726
-
MutationGFPmut2 was derived from avGFP with the following mutations: S65A/V68L/S72A
- Promoter Ptet+dnaK P1
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCATGTTTGACAGCTTATCATCGATAAGC
- 3′ sequencing primer GGCGGTTATTTGTACAATTCATCCATACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycda promoter was amplified from pANO1::cda’ that was gift from Dr. Lars Hestbjerg Hansen and is published in Norman, A., Hansen, L. H. & Sørensen, S. J. Construction of a ColD cda promoter-based SOS-green fluorescent protein whole-cell biosensor with higher sensitivity toward genotoxic compounds than constructs based on recA, umuDC, or sulA 1135 promoters. Appl. Environ. Microbiol. 71, 2338–2346 (2005).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.06.622235 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAED2 was a gift from Tanel Tenson (Addgene plasmid # 234599 ; http://n2t.net/addgene:234599 ; RRID:Addgene_234599) -
For your References section:
Antibacterial compounds against non-growing and intracellular bacteria. Kaldalu N, Berzins N, Berglund Fick S, Sharma A, Andersson NC, Aedla J, Hinnu M, Puhar A, Hauryliuk V, Tenson T. NPJ Antimicrob Resist. 2025 Apr 11;3(1):25. doi: 10.1038/s44259-025-00097-0. 10.1038/s44259-025-00097-0 PubMed 40216902