pJRoC30-LaccID
(Plasmid
#234652)
-
PurposeExpresses LaccID evolved variant in yeast
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJRoC30
- Backbone size w/o insert (bp) 10541
- Total vector size (bp) 12377
-
Modifications to backboneThis vector was a modified version containing in the C-terminal a HRV 3C protease site, GSG linker, and 8xHis tag
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaccID
-
SpeciesSynthetic
-
Insert Size (bp)1767
-
MutationV11A, Q45R, N74S, R121S, I126V, D255G, L300V
- Promoter Gal1p
-
Tag
/ Fusion Protein
- HRV 3C protease site-GSG linker-8xHis tag (C terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CCTCTATACTTTAACGTCAAGG (RMLN)
- 3′ sequencing primer GGGAGGGCGTGAATGTAAGC (RMLC)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.29.620861 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJRoC30-LaccID was a gift from Miguel Alcalde Galeote & Alice Ting (Addgene plasmid # 234652 ; http://n2t.net/addgene:234652 ; RRID:Addgene_234652) -
For your References section:
Directed evolution of LaccID for cell surface proximity labeling and electron microscopy. Lee SY, Roh H, Gonzalez-Perez D, Mackey MR, Hoces D, McLaughlin CN, Lin C, Adams SR, Nguyen K, Kim KY, Luginbuhl DJ, Luo L, Udeshi ND, Carr SA, Hernandez-Lopez RA, Ellisman MH, Alcalde M, Ting AY. Nat Chem Biol. 2025 Aug 1. doi: 10.1038/s41589-025-01973-6. 10.1038/s41589-025-01973-6 PubMed 40751001