Skip to main content
Addgene

pJRoC30-LacAnc100
(Plasmid #234653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234653 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJRoC30
  • Backbone size w/o insert (bp) 10541
  • Total vector size (bp) 12377
  • Modifications to backbone
    This vector was a modified version containing in the C-terminal a HRV 3C protease site, GSG linker, and 8xHis tag
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacAnc100
  • Species
    Synthetic
  • Insert Size (bp)
    1767
  • Promoter Gal1p
  • Tag / Fusion Protein
    • HRV 3C protease site-GSG linker-8xHis tag (C terminal on backbone)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CCTCTATACTTTAACGTCAAGG (RMLN)
  • 3′ sequencing primer GGGAGGGCGTGAATGTAAGCG (RMLC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The LacAnc100 gene is an ancestral laccase previously designed in our publication: Bernardo J Gomez-Fernandez, Valeria A Risso, Andres Rueda, Jose M Sanchez-Ruiz, and Miguel Alcalde. (2020). Ancestral Resurrection and Directed Evolution of Fungal Mesozoic Laccases. Appl Environ Microbiol 86(14):e00778-20. doi: 10.1128/AEM.00778-20.

Please visit https://doi.org/10.1101/2024.10.29.620861 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJRoC30-LacAnc100 was a gift from Miguel Alcalde Galeote & Alice Ting (Addgene plasmid # 234653 ; http://n2t.net/addgene:234653 ; RRID:Addgene_234653)
  • For your References section:

    Directed evolution of LaccID for cell surface proximity labeling and electron microscopy. Lee SY, Roh H, Gonzalez-Perez D, Mackey MR, Hoces D, McLaughlin CN, Lin C, Adams SR, Nguyen K, Kim KY, Luginbuhl DJ, Luo L, Udeshi ND, Carr SA, Hernandez-Lopez RA, Ellisman MH, Alcalde M, Ting AY. Nat Chem Biol. 2025 Aug 1. doi: 10.1038/s41589-025-01973-6. 10.1038/s41589-025-01973-6 PubMed 40751001