cBEST3
(Plasmid
#234659)
-
PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMDY23
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Low Chloramphenicol, 12.5 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namespCas9 cytosine base editor
-
Alt nameAPOBEC1-spCas9n-UGI fusion protein
-
SpeciesSynthetic
-
Insert Size (bp)5100
- Promoter P3
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer GCAATTAACCCTCACTAAAGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGolden Gate compatible sgRNA insertion cassette
-
SpeciesSynthetic
- Promoter kasO17tss
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGAAACGCCTGGTATCTTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBase editor coding sequence was obtained from pCRISPR-cBEST (Addgene 125689) Golden Gate-compatible sgRNA cassette was obtained from pCRISPomyces-2 (Addgene 61737)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cBEST3 was a gift from Mingzi M. Zhang (Addgene plasmid # 234659 ; http://n2t.net/addgene:234659 ; RRID:Addgene_234659) -
For your References section:
Highly efficient CRISPR-Cas9 base editing in Bifidobacterium with bypass of restriction modification systems. Lin H-C, Hsiao W-C, Hsu Y-C, Lin M-C, Hsu C-C, Zhang MM. Appl Environ Microbiol. 2025 Mar 10:e0198524. doi: 10.1128/aem.01985-24. 10.1128/aem.01985-24 PubMed 40062897