Skip to main content

cBEST3
(Plasmid #234659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234659 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMDY23
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Low Chloramphenicol, 12.5 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    spCas9 cytosine base editor
  • Alt name
    APOBEC1-spCas9n-UGI fusion protein
  • Species
    Synthetic
  • Insert Size (bp)
    5100
  • Promoter P3

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer GCAATTAACCCTCACTAAAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Golden Gate compatible sgRNA insertion cassette
  • Species
    Synthetic
  • Promoter kasO17tss

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGAAACGCCTGGTATCTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Base editor coding sequence was obtained from pCRISPR-cBEST (Addgene 125689) Golden Gate-compatible sgRNA cassette was obtained from pCRISPomyces-2 (Addgene 61737)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cBEST3 was a gift from Mingzi M. Zhang (Addgene plasmid # 234659 ; http://n2t.net/addgene:234659 ; RRID:Addgene_234659)
  • For your References section:

    Highly efficient CRISPR-Cas9 base editing in Bifidobacterium with bypass of restriction modification systems. Lin H-C, Hsiao W-C, Hsu Y-C, Lin M-C, Hsu C-C, Zhang MM. Appl Environ Microbiol. 2025 Mar 10:e0198524. doi: 10.1128/aem.01985-24. 10.1128/aem.01985-24 PubMed 40062897
Commonly requested with: