pAAV-CAG-FlpX-mKate2.0-N2cG
(Plasmid
#234711)
-
PurposepAAV transfer plasmid with CAG promoter driving Flp-dependent expression of mKate2.0 and N2c G protein separated by a T2A linker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5331
- Total vector size (bp) 8067
-
Modifications to backboneincludes fDIO cassette adding 380 bp
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKate2.0 T2A N2cG
-
SpeciesSynthetic; synthetic and Lyssavirus rabies
-
Insert Size (bp)2343
-
GenBank IDMN744966.1 AAB97690.1
- Promoter CAG
-
Tag
/ Fusion Protein
- T2A (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sbfi (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer gtgctggttattgtgctgtctcatca
- 3′ sequencing primer gtaatccagaggttgattatcgataagctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.08.28.610136 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FlpX-mKate2.0-N2cG was a gift from David Ng (Addgene plasmid # 234711 ; http://n2t.net/addgene:234711 ; RRID:Addgene_234711) -
For your References section:
Segregated basal ganglia output pathways correspond to genetically divergent neuronal subclasses. Mendelsohn AI, Nikoobakht L, Bikoff JB, Costa RM. bioRxiv [Preprint]. 2024 Sep 18:2024.08.28.610136. doi: 10.1101/2024.08.28.610136. 10.1101/2024.08.28.610136 PubMed 39257765