Skip to main content
Addgene

pAAV-CAG-FlpX-mKate2.0-N2cG
(Plasmid #234711)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 234711 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5331
  • Total vector size (bp) 8067
  • Modifications to backbone
    includes fDIO cassette adding 380 bp
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2.0 T2A N2cG
  • Species
    Synthetic; synthetic and Lyssavirus rabies
  • Insert Size (bp)
    2343
  • GenBank ID
    MN744966.1 AAB97690.1
  • Promoter CAG
  • Tag / Fusion Protein
    • T2A (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sbfi (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer gtgctggttattgtgctgtctcatca
  • 3′ sequencing primer gtaatccagaggttgattatcgataagctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.08.28.610136 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-FlpX-mKate2.0-N2cG was a gift from David Ng (Addgene plasmid # 234711 ; http://n2t.net/addgene:234711 ; RRID:Addgene_234711)
  • For your References section:

    Segregated basal ganglia output pathways correspond to genetically divergent neuronal subclasses. Mendelsohn AI, Nikoobakht L, Bikoff JB, Costa RM. bioRxiv [Preprint]. 2024 Sep 18:2024.08.28.610136. doi: 10.1101/2024.08.28.610136. 10.1101/2024.08.28.610136 PubMed 39257765