pTcTurboID-GW_GFP
(Plasmid
#234715)
-
PurposeUsed to express GFP fused to 3xHA-TurboID (N-terminal) in T. cruzi. Tetracycline regulated. Used as proximity labelling cytoplasmatic spatial control. CDS can be cloned in frame to GFP using EcoRV.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTcTurboID-GW
-
Vector typeTrypanosomatid expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesOther
- Promoter T7
-
Tag
/ Fusion Protein
- 3xHA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ataaacagggagccctgc
- 3′ sequencing primer CAAGGACAGAAAACGGTAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
If you want to perform traditional cloning (instead of Gateway recombiantion), it can be achieved by replacing the GFP cassette from pTcTurboID-GW_GFP with the desired CDS using BamHI and EcoRV restriction enzymes. Also, any CDS can be cloned in frame to GFP using only EcoRV.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTcTurboID-GW_GFP was a gift from Esteban Serra (Addgene plasmid # 234715 ; http://n2t.net/addgene:234715 ; RRID:Addgene_234715)