Skip to main content

pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
(Plasmid #234737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234737 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
  • Backbone manufacturer
    Kirill Martemyanov, Addgene plasmid #234724
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nrl
  • gRNA/shRNA sequence
    GTATGGTGTGGAGCCCAACG
  • Species
    M. musculus (mouse)
  • GenBank ID
    18185
  • Entrez Gene
    Nrl (a.k.a. D14H14S46E)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori was a gift from Kirill Martemyanov (Addgene plasmid # 234737 ; http://n2t.net/addgene:234737 ; RRID:Addgene_234737)
  • For your References section:

    Efficient in vivo labeling of endogenous proteins with SMART delineates retina cellular and synaptic organization. Zhao C, Cao Y, Ibrahim N, Wang Y, Martemyanov KA. Nat Commun. 2025 Apr 22;16(1):3768. doi: 10.1038/s41467-025-58945-6. 10.1038/s41467-025-58945-6 PubMed 40263339