lentiCRISPRv2-sgCTL
(Plasmid
#234771)
-
PurposeNon Targeting Control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPRv2
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52961
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNon Targeting Control sgRNA
-
gRNA/shRNA sequenceCAACAAGATGAAGAGCACCAA
-
SpeciesH. sapiens (human), M. musculus (mouse)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2-sgCTL was a gift from Judy Lieberman (Addgene plasmid # 234771 ; http://n2t.net/addgene:234771 ; RRID:Addgene_234771) -
For your References section:
Gasdermin D permeabilization of mitochondrial inner and outer membranes accelerates and enhances pyroptosis. Miao R, Jiang C, Chang WY, Zhang H, An J, Ho F, Chen P, Zhang H, Junqueira C, Amgalan D, Liang FG, Zhang J, Evavold CL, Hafner-Bratkovic I, Zhang Z, Fontana P, Xia S, Waldeck-Weiermair M, Pan Y, Michel T, Bar-Peled L, Wu H, Kagan JC, Kitsis RN, Zhang P, Liu X, Lieberman J. Immunity. 2023 Nov 14;56(11):2523-2541.e8. doi: 10.1016/j.immuni.2023.10.004. Epub 2023 Nov 3. 10.1016/j.immuni.2023.10.004 PubMed 37924812