Skip to main content
Addgene

A24M04 Ig kappa light chain-pFEEKW
(Plasmid #234810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234810 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFEEKW (VRC9736)
  • Backbone size w/o insert (bp) 8846
  • Total vector size (bp) 9551
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A24M04 Igkappa light chain
  • Alt name
    A24M04 Igkappa LC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    705
  • GenBank ID
    PV067160
  • Entrez Gene
    IGKC (a.k.a. HCAK1, IGKCD, Km)
  • Entrez Gene
    IGK (a.k.a. IGK@)
  • Promoter EEK promoter

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer seq 1F: TTACAGTTGACCCGTACGTG (vector), seq 2F: TAGGGTGACCATCACATGCA (Insert)
  • 3′ sequencing primer seq4R: TTCCCGTATGGCTTTCATTT (vector)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Denise A. Galloway, Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

VH and VL nucleotide sequences of A24M04, an IgG monoclonal antibody clone specific for HPV16 L1 epitope were obtained from Dr. Galloway's lab and we constructed this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A24M04 Ig kappa light chain-pFEEKW was a gift from Susan Pierce (Addgene plasmid # 234810 ; http://n2t.net/addgene:234810 ; RRID:Addgene_234810)
  • For your References section:

    In the activation of HPV-specific human B cells HPV-VLP vaccines mimic membrane-associated antigens. Torgbor C, Sohn H, Dizon BLP, Mutic EC, George R, Kwak K, Akkaya M, Ulker EB, Traver M, Brzostowski J, Galloway DA, Thompson CD, Cuburu N, Schiller JT, Pierce SK. Proc Natl Acad Sci U S A. 2025 Mar 11;122(10):e2414514122. doi: 10.1073/pnas.2414514122. Epub 2025 Mar 3. 10.1073/pnas.2414514122 PubMed 40030014