Skip to main content
Addgene

pDY1513 AAVS1 sgRNA
(Plasmid #234832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234832 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-pegRNA-GG-acceptor (Addgene #132777)
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1 sgRNA
  • gRNA/shRNA sequence
    gaaggaggaggcctaaggat

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDY1513 AAVS1 sgRNA was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 234832 ; http://n2t.net/addgene:234832 ; RRID:Addgene_234832)
  • For your References section:

    Reprogramming site-specific retrotransposon activity to new DNA sites. Fell CW, Villiger L, Lim J, Hiraizumi M, Tagliaferri D, Yarnall MTN, Lee A, Jiang K, Kayabolen A, Krajeski RN, Schmitt-Ulms C, Ramani H, Yousef SM, Roberts N, Vakulskas CA, Nishimasu H, Abudayyeh OO, Gootenberg JS. Nature. 2025 Apr 9. doi: 10.1038/s41586-025-08877-4. 10.1038/s41586-025-08877-4 PubMed 40205048