Skip to main content
Addgene

pDY1622 NOLC1 sgRNA 1
(Plasmid #234833)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234833 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pU6-pegRNA-GG-acceptor (Addgene #132777)
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NOLC1 sgRNA
  • gRNA/shRNA sequence
    gacgcgtattgcctggagga
  • Species
    H. sapiens (human)
  • Entrez Gene
    NOLC1 (a.k.a. NOPP130, NOPP140, NS5ATP13, P130, Srp40)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDY1622 NOLC1 sgRNA 1 was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 234833 ; http://n2t.net/addgene:234833 ; RRID:Addgene_234833)

  • For your References section:

    Reprogramming site-specific retrotransposon activity to new DNA sites. Fell CW, Villiger L, Lim J, Hiraizumi M, Tagliaferri D, Yarnall MTN, Lee A, Jiang K, Kayabolen A, Krajeski RN, Schmitt-Ulms C, Ramani H, Yousef SM, Roberts N, Vakulskas CA, Nishimasu H, Abudayyeh OO, Gootenberg JS. Nature. 2025 Apr 9. doi: 10.1038/s41586-025-08877-4. 10.1038/s41586-025-08877-4 PubMed 40205048
Related items:
Commonly requested with: