pDY1623 NOLC1 sgRNA 2
(Plasmid
#234834)
-
PurposesgRNA 2 for NOLC1 STITCHR insertion
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-pegRNA-GG-acceptor (Addgene #132777)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNOLC1 sgRNA
-
gRNA/shRNA sequencegggaaccacgcggcgaatgc
-
SpeciesH. sapiens (human)
-
Entrez GeneNOLC1 (a.k.a. NOPP130, NOPP140, NS5ATP13, P130, Srp40)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDY1623 NOLC1 sgRNA 2 was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 234834 ; http://n2t.net/addgene:234834 ; RRID:Addgene_234834) -
For your References section:
Reprogramming site-specific retrotransposon activity to new DNA sites. Fell CW, Villiger L, Lim J, Hiraizumi M, Tagliaferri D, Yarnall MTN, Lee A, Jiang K, Kayabolen A, Krajeski RN, Schmitt-Ulms C, Ramani H, Yousef SM, Roberts N, Vakulskas CA, Nishimasu H, Abudayyeh OO, Gootenberg JS. Nature. 2025 Apr 9. doi: 10.1038/s41586-025-08877-4. 10.1038/s41586-025-08877-4 PubMed 40205048