PGK-HA-PGRN
(Plasmid
#234872)
-
PurposeLentiviral plasmid expressing HA-tagged human progranulin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK-GFP.WPRE
-
Backbone manufacturerDidier Trono (Addgene #12252)
- Backbone size w/o insert (bp) 6652
- Total vector size (bp) 8470
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProgranulin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1818
-
Entrez GeneGRN (a.k.a. CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN)
- Promoter PGK
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gggtgtggggcggtagtg
- 3′ sequencing primer cataaagagacagcaaccagga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriGene Technologies (human GRN plasmid)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK-HA-PGRN was a gift from Andrew Arrant (Addgene plasmid # 234872 ; http://n2t.net/addgene:234872 ; RRID:Addgene_234872) -
For your References section:
Delivering progranulin to neuronal lysosomes protects against excitotoxicity. Davis SE, Roth JR, Aljabi Q, Hakim AR, Savell KE, Day JJ, Arrant AE. J Biol Chem. 2021 Sep;297(3):100993. doi: 10.1016/j.jbc.2021.100993. Epub 2021 Jul 21. 10.1016/j.jbc.2021.100993 PubMed 34298019