Skip to main content

PGK-GFP-LAMP1TM
(Plasmid #234874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Didier Trono (Addgene #12252)
  • Backbone size w/o insert (bp) 6661
  • Total vector size (bp) 7495
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    834
  • Promoter PGK
  • Tag / Fusion Protein
    • LAMP-1 transmembrane domain and cytosolic tail (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gggtgtggggcggtagtg
  • 3′ sequencing primer cataaagagacagcaaccagga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    IDT (LAMP-1 TM obtained as G block and cloned into Addgene #12252)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGK-GFP-LAMP1TM was a gift from Andrew Arrant (Addgene plasmid # 234874 ; http://n2t.net/addgene:234874 ; RRID:Addgene_234874)
  • For your References section:

    Delivering progranulin to neuronal lysosomes protects against excitotoxicity. Davis SE, Roth JR, Aljabi Q, Hakim AR, Savell KE, Day JJ, Arrant AE. J Biol Chem. 2021 Sep;297(3):100993. doi: 10.1016/j.jbc.2021.100993. Epub 2021 Jul 21. 10.1016/j.jbc.2021.100993 PubMed 34298019