pLVXNeo_SPARC-mSc-SBP
(Plasmid
#234885)
-
PurposeExpresses mScarlet-i and SBP tagged human SPARC for protein visualisation and use in the RUSH trafficking system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVXNeo
-
Backbone manufacturerTakara
- Backbone size w/o insert (bp) 8317
- Total vector size (bp) 10117
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSPARC
-
Alt nameSPARC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1800
-
MutationN/A
-
GenBank IDNM_003118.4
-
Entrez GeneSPARC (a.k.a. BM-40, OI17, ON, ONT)
- Promoter CMV
-
Tags
/ Fusion Proteins
- SBP (C terminal on insert)
- mScarleti (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVXNeo_SPARC-mSc-SBP was a gift from Nicola Stevenson (Addgene plasmid # 234885 ; http://n2t.net/addgene:234885 ; RRID:Addgene_234885) -
For your References section:
Multiple golgins are required to support extracellular matrix secretion, modification, and assembly. Thompson G, Hoyle A, Lewis PA, Prada-Sanchez ME, Swift J, Heesom K, Lowe M, Stephens D, Stevenson NL. J Cell Biol. 2025 Oct 6;224(10):e202411167. doi: 10.1083/jcb.202411167. Epub 2025 Aug 18. 10.1083/jcb.202411167 PubMed 40824304